Journal:

Article Title: Use of Aqueous Silver To Enhance Inactivation of Coliphage MS-2 by UV Disinfection

doi: 10.1128/AEM.70.5.2848-2853.2004

Figure Lengend Snippet: Inactivation of MS-2 by silver (0.1 mg/liter for 130 min) (column 1) and UV radiation (ca. 40 mJ/cm2) (column 2); (column 3) sum of columns 1 and 2; (column 4) silver (0.1 mg/liter for 10 min) followed by UV radiation (ca. 40 mJ/cm2) and then neutralized immediately (10-min total silver exposure); (column 5) silver (0.1 mg/liter for 10 min) followed by UV radiation (ca. 40 mJ/cm2) and then neutralized 120 min after exposure to UV (130-min total silver exposure). The difference between column 3 and column 5 was found to be statistically significant (P < 0.0001). Error bars represent 1 standard deviation.

Article Snippet: Freeze-dried MS-2 (ATCC 15597-B1) was mixed with 1.5 ml of a 24-h culture of E. coli and 3.0 ml of melted (45°C) TSB soft agar (0.5% [wt/vol] agar).

Techniques: Standard Deviation

Journal:

Article Title: Use of Aqueous Silver To Enhance Inactivation of Coliphage MS-2 by UV Disinfection

doi: 10.1128/AEM.70.5.2848-2853.2004

Figure Lengend Snippet: Inactivation of MS-2 as a function of fluence and silver concentration in a phosphate-buffered solution (pH 7.2). Fluence data for UV only (⧫) pass through the origin. The lowest fluence data for the samples containing silver (▪ and ▴) were 1 mJ/cm2. Samples that were first exposed to silver (0.05 or 1 mg of Ag/liter) were incubated for 73 min including the time required to achieve the specified fluence. Error bars represent 1 standard deviation.

Article Snippet: Freeze-dried MS-2 (ATCC 15597-B1) was mixed with 1.5 ml of a 24-h culture of E. coli and 3.0 ml of melted (45°C) TSB soft agar (0.5% [wt/vol] agar).

Techniques: Concentration Assay, Incubation, Standard Deviation

Journal:

Article Title: Use of Aqueous Silver To Enhance Inactivation of Coliphage MS-2 by UV Disinfection

doi: 10.1128/AEM.70.5.2848-2853.2004

Figure Lengend Snippet: Inactivation of MS-2 as a function of silver concentration for a fluence of ca. 40 mJ/cm2. Silver incubation time was 10 min. Error bars represent 1 standard deviation.

Article Snippet: Freeze-dried MS-2 (ATCC 15597-B1) was mixed with 1.5 ml of a 24-h culture of E. coli and 3.0 ml of melted (45°C) TSB soft agar (0.5% [wt/vol] agar).

Techniques: Concentration Assay, Incubation, Standard Deviation

Journal: Cell Reports Medicine

Article Title: Antibodies against viral nucleo-, phospho-, and X protein contribute to serological diagnosis of fatal Borna disease virus 1 infections

doi: 10.1016/j.xcrm.2021.100499

Figure Lengend Snippet:

Article Snippet: MS2: , , , Metabion; , N/A.

Techniques: Virus, Isolation, Clinical Proteomics, Infection, Western Blot, Diagnostic Assay, Recombinant, Software, Membrane

Journal:

Article Title: Rapid Semiautomated Subtyping of Influenza Virus Species during the 2009 Swine Origin Influenza A H1N1 Virus Epidemic in Milwaukee, Wisconsin ▿

doi: 10.1128/JCM.00999-09

Figure Lengend Snippet: In silico coverage by the primers and probes used in the Seasonal assay and the H1 S-OIV assay

Article Snippet: One of the sequences not covered in silico was from one of our own isolates that we had detected with the H1 S-OIV assay and then sequenced. table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Organism Primer name Primer sequence a Target Total no. of sequences No. of hits No. of gaps Coverage (%) RSV RSV-L3 AATAAATCATAAGTCA*GTAGTA*GACCATGT L gene 16 16 0 100.0 RSV-E4 AATAAATCATAATAAGCT*GGTA*TTGA*TGCA L gene 16 16 0 100.0 RSV-FAM12 MGB-Fam-TTGAT*GCA*GG*GA*ATTCA*CA-EDQ L gene 16 16 0 100.0 Total for RSV 16 16 0 100.0 Influenza A virus INFA-L30 AATAAATCATAAGTCAGAGGTGACAGGATTGG M gene 3,767 3,723 6 99.0 INFA-E7 AATAAATCATAACTCA*TGGA*ATGGCTAAAG M gene 3,767 3,705 9 98.6 INFA-E8 AATAAATCATAACTCA*TGGA*GTGGCTAAAG M gene 3,767 3,496 9 93.0 INFA-FAM42 MGB-Fam-AAG*ACA*A*GA*CCZ*A*T*-EDQ M gene 3,767 3,760 7 100.0 Total for influenza A virus 3,767 3,677 9 97.8 Influenza B virus DIF430-L30 AATAAATCATAAGCCTTCTCCA*TCTTCTG M gene 364 282 82 100.0 DIF430-E24 AATAAATCATAAGTCGCTGTTTGGA*GACAC M gene 364 314 42 97.5 DIF430-FAM37 MGB-Fam-AGCAGGTA*GGCA*ATTGT-EDQ M gene 364 291 73 100.0 Total for influenza B virus 364 274 82 97.2 H1 (human) virus H1-L17 AATAAATCATAAGTA*GTGTCTTCACA*TTATAGCA HA gene 1,463 1,436 27 100.0 H1-E19 AATAAATCATAATGATCTCTCA*CCTTGGGTCTT HA gene 1,463 1,379 27 96.0 H1-E20 AATAAATCATAATGA*TCTCTTA*CTTTGGGTCTT HA gene 1,463 1,411 27 98.3 H1-AP593-16 MGB-AP-593-CAGAAATAGCCAAAAGAC-EDQ HA gene 1,463 1,436 27 100.0 Total for H1 (human) virus 1,463 1,411 27 98.3 H3 virus H3-L4 AATAAATCATAACCCT*GT*GCTGT*T*A*ATCA HA gene 4,016 3,906 6 97.4 H3-E9 AATAAATCATAAGA*ATAAGCA*TCTA*TTGGAC HA gene 4,016 4,004 6 99.9 H3-AP593-2 MGB-AP-593-G*G*TTTTA*CTATTGTCCAA-EDQ HA gene 4,016 4,005 6 99.9 Total for H3 virus 4,016 3,900 6 97.3 H1 virus (S-OIV) H1Sw_For652 + 22 AATAAATCATAAGTGGGGTCATCAAGATACAGCA HA gene 555 551 1 99.5 b H1Sw_Rev719-21 AATAAATCATAATGATCCCTCACTTTGGGTCTT HA gene 555 552 1 99.6 H1Sw_Probe684 + 20FAM 6-Fam-GCCGGAAATAGCAATAAGAC-BHQ1 HA gene 555 554 1 100.0 Total for H1 virus (S-OIV) 555 549 1 99.1 MS2 phage MS2-L23 AATAAATCATAAGGTCGGTA*CTAACA*TCAAG NA d NA NA NA MS2-E7 AATAAATCATAAGCA*CGTTGT*CTGGAAGTT NA NA NA NA MS2-AP593-7 c MGB-AP-593-CG*TATCCA*G*CTG*CA*AA*CT-EDQ NA NA NA NA MS2-AP593-6 c MGB-AP-593-CGTATCCA*GCTGCA*AA*CT-EDQ NA NA NA NA Open in a separate window a * indicates that the previous base is a proprietary superbase (Nanogen, Inc., Bothell, WA).

Techniques: In Silico, Sequencing, Virus